Documentation ¶
Overview ¶
Package sam implements a SAM file parser and writer.
SAM is a tab-delimited text format for storing DNA/RNA sequence alignment data. It is the most widely used alignment format, complementing its binary equivalent, BAM, which stores the same data in a compressed format.
DNA sequencing works in the following way:
- DNA is read in with some raw signal format from the sequencer machine.
- Raw signal is converted to fastq reads using basecalling software.
- Fastq reads are aligned to target template, producing SAM files.
- SAM files are used to answer bioinformatic queries.
This parser allows parsing and writing of SAM files in Go. Unlike other SAM parsers in Golang, we aim to be as close to underlying data types as possible, with a goal of being as simple as possible, and no simpler.
Paper: https://doi.org/10.1093%2Fbioinformatics%2Fbtp352 Spec: http://samtools.github.io/hts-specs/SAMv1.pdf Spec(locally): `dnadesign/lib/bio/sam/SAMv1.pdf`
Index ¶
Examples ¶
Constants ¶
const DefaultMaxLineSize int = 1024 * 32 * 2 // // 32kB is a magic number often used by the Go stdlib for parsing. We multiply it by two.
Variables ¶
This section is empty.
Functions ¶
func NewParser ¶
NewParser creates a parser from an io.Reader for sam data. For larger alignments, you will want to increase the maxLineSize.
Example ¶
file := strings.NewReader(`@HD VN:1.6 SO:unsorted GO:query @SQ SN:pOpen_V3_amplified LN:2482 @PG ID:minimap2 PN:minimap2 VN:2.24-r1155-dirty CL:minimap2 -acLx map-ont - APX814_pass_barcode17_e229f2c8_109f9b91_0.fastq.gz ae9a66f5-bf71-4572-8106-f6f8dbd3b799 16 pOpen_V3_amplified 1 60 8S54M1D3M1D108M1D1M1D62M226S * 0 0 AGCATGCCGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGTGCTGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCGACGTTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTTACTGTTGATGTTCATGTAGGTGCTGATCAGAGGTACTTTCCTGGAGGGTTTAACCTTAGCAATACGTAACGGAACGAAGTACAGGGCAT %,<??@@{O{HS{{MOG{EHD@@=)))'&%%%%'(((6::::=?=;:7)'''/33387-)(*025557CBBDDFDECD;1+'(&&')(,-('))35@>AFDCBD{LNKKGIL{{JLKI{{IFG>==86668789=<><;056<;>=87:840/++1,++)-,-0{{&&%%&&),-13;<{HGVKCGFI{J{L{G{INJHEA@C540/3568;>EOI{{{I0000HHRJ{{{{{{{RH{N@@?AKLQEEC?==<433345588==FTA??A@G?@@@EC?==;10//2333?AB?<<<--(++*''&&-(((+@DBJQHJHGGPJH{.---@B?<''-++'--&%%&,,,FC:999IEGJ{HJHIGIFEGIFMDEF;8878{KJGFIJHIHDCAA=<<<<;DDB>:::EK{{@{E<==HM{{{KF{{{MDEQM{ECA?=>9--,.3))'')*++.-,**()%% NM:i:8 ms:i:408 AS:i:408 nn:i:0 tp:A:P cm:i:29 s1:i:195 s2:i:0 de:f:0.0345 SA:Z:pOpen_V3_amplified,2348,-,236S134M1D92S,60,1; rl:i:0`) parser, _, _ := NewParser(file, DefaultMaxLineSize) samLine, _ := parser.Next() fmt.Println(samLine.CIGAR)
Output: 8S54M1D3M1D108M1D1M1D62M226S
Types ¶
type Alignment ¶
type Alignment struct { QNAME string // Query template NAME FLAG uint16 // bitwise FLAG RNAME string // References sequence NAME POS int32 // 1- based leftmost mapping POSition MAPQ byte // MAPping Quality CIGAR string // CIGAR string RNEXT string // Ref. name of the mate/next read PNEXT int32 // Position of the mate/next read TLEN int32 // observed Template LENgth SEQ string // segment SEQuence QUAL string // ASCII of Phred-scaled base QUALity+33 Optionals []Optional // Map of TAG to {TYPE:DATA} }
Each alignment is a single line of a SAM file, representing a linear alignment of a segment, consisting of 11 or more tab delimited fields. The 11 fields (QNAME -> QUAL) are always available (if the data isn't there, a placeholder '0' or '*' is used instead), with additional optional fields following.
For more information, check section 1.4 of the reference document.
type Header ¶
type Header struct { HD map[string]string // File-level metadata. Optional. If present, there must be only one @HD line and it must be the first line of the file. SQ []map[string]string // Reference sequence dictionary. The order of @SQ lines defines the alignment sorting order. RG []map[string]string // Read group. Unordered multiple @RG lines are allowed. PG []map[string]string // Program. CO []string // One-line text comment. Unordered multiple @CO lines are allowed. UTF-8 encoding may be used. }
Each header in a SAM file begins with an @ followed by a two letter record code type. Each line is tab delimited, and contains TAG:VALUE pairs. HD, the first line, only occurs once, while SQ, RG, and PG can appear multiple times. Finally, @CO contains user generated comments.
For more information, check section 1.3 of the reference document.
type Optional ¶
type Optional struct { Tag string // Tag is typically a two letter tag corresponding to what the optional represents. Type rune // The type may be one of A (character), B (general array), f (real number), H (hexadecimal array), i (integer), or Z (string). Data string // Optional data }
Optional fields in SAM alignments are structured as TAG:TYPE:DATA, where the type identifiers the typing of the data.
For more information, check section 1.5 of http://samtools.github.io/hts-specs/SAMv1.pdf.