Documentation
¶
Overview ¶
Package fastq contains fastq parsers and writers.
Fastq is a flat text file format developed in ~2000 to store nucleotide sequencing data. While similar to fastq, fastq has a few differences. First, the sequence identifier begins with @ instead of >, and includes quality values for a sequence.
This package provides a parser and writer for working with Fastq formatted sequencing data.
Index ¶
Examples ¶
Constants ¶
This section is empty.
Variables ¶
This section is empty.
Functions ¶
func Write ¶
Write writes a fastq array to a file.
Example ¶
ExampleWrite shows basic usage of the writer.
package main
import (
"fmt"
"os"
_ "embed"
"github.com/bebop/poly/io/fastq"
)
func main() {
fastqs, _ := fastq.Read("data/nanosavseq.fastq") // get example data
_ = fastq.Write(fastqs, "data/test.fastq") // write it out again
testSequence, _ := fastq.Read("data/test.fastq") // read it in again
os.Remove("data/test.fastq") // getting rid of test file
fmt.Println(testSequence[0].Identifier)
fmt.Println(testSequence[0].Sequence)
fmt.Println(testSequence[0].Quality)
}
Output: e3cc70d5-90ef-49b6-bbe1-cfef99537d73 GATGTGCGCCGTTCCAGTTGCGACGTACTATAATCCCCGGCAACACGGTGCTGATTCTCTTCCTGTTCCAGAAAGCATAAACAGATGCAAGTCTGGTGTGATTAACTTCACCAAAGGGCTGGTTGTAATATTAGGAAATCTAACAATAGATTCTGTTGGTTGGACTCTAAAATTAGAAATTTGATAGATTCCTTTTCCCAAATGAAAGTTTAACGTACACTTTGTTTCTAAAGGAAGGTCAAATTACAGTCTACAGCATCGTAATGGTTCATTTTCATTTATATTTTAATACTAGAAAAGTCCTAGGTTGAAGATAACCACATAATAAGCTGCAACTTCAGCTGTCCCAACCTGAAGAAGAATCGCAGGAGTCGAAATAACTTCTGTAAAGCAAGTAGTTTGAACCTATTGATGTTTCAACATGAGCAATACGTAACT $$&%&%#$)*59;/767C378411,***,('11<;:,0039/0&()&'2(/*((4.1.09751).601+'#&&&,-**/0-+3558,/)+&)'&&%&$$'%'%'&*/5978<9;**'3*'&&A?99:;:97:278?=9B?CLJHGG=9<@AC@@=>?=>D>=3<>=>3362$%/((+/%&+//.-,%-4:+..000,&$#%$$%+*)&*0%.//*?<<;>DE>.8942&&//074&$033)*&&&%**)%)962133-%'&*99><<=1144??6.027639.011/-)($#$(/422*4;:=122>?@6964:.5'8:52)*675=:4@;323&&##'.-57*4597)+0&:7<7-550REGB21/0+*79/&/6538())+)+23665+(''$$$'-2(&&*-.-#$&%%$$,-)&$$#$'&,);;<C<@454)#'
Types ¶
type Fastq ¶
type Fastq struct {
Identifier string `json:"identifier"`
Optionals map[string]string `json:"optionals"` // Nanopore, for example, carries along data like: read=13956 ch=53 start_time=2020-11-11T01:49:01Z
Sequence string `json:"sequence"`
Quality string `json:"quality"`
}
Fastq is a struct representing a single Fastq file element with an Identifier, its corresponding sequence, its quality score, and any optional pieces of data.
func Parse ¶
Parse parses a given Fastq file into an array of Fastq structs. Internally, it uses ParseFastqConcurrent.
func Read ¶
Read reads a file into an array of Fastq structs
Example ¶
ExampleRead shows basic usage for Read.
package main
import (
"fmt"
_ "embed"
"github.com/bebop/poly/io/fastq"
)
func main() {
fastqs, _ := fastq.Read("data/nanosavseq.fastq")
fmt.Println(fastqs[0].Identifier)
}
Output: e3cc70d5-90ef-49b6-bbe1-cfef99537d73
func ReadGz ¶
ReadGz reads a gzipped file into an array of Fastq structs.
Example ¶
ExampleReadGz shows basic usage for ReadGz.
package main
import (
"fmt"
_ "embed"
"github.com/bebop/poly/io/fastq"
)
func main() {
fastqs, _ := fastq.ReadGz("data/nanosavseq.fastq.gz")
fmt.Println(fastqs[0].Identifier)
}
Output: e3cc70d5-90ef-49b6-bbe1-cfef99537d73
type Parser ¶
type Parser struct {
// contains filtered or unexported fields
}
Parser is a flexible parser that provides ample control over reading fastq-formatted sequences. It is initialized with NewParser.
Example ¶
package main
import (
"fmt"
"strings"
_ "embed"
"github.com/bebop/poly/io/fastq"
)
//go:embed data/nanosavseq.fastq
var baseFastq string
func main() {
parser := fastq.NewParser(strings.NewReader(baseFastq), 2*32*1024)
for {
fastq, _, err := parser.ParseNext()
if err != nil {
fmt.Println(err)
break
}
fmt.Println(fastq.Identifier)
}
}
Output: e3cc70d5-90ef-49b6-bbe1-cfef99537d73 92728f25-b658-426c-8cd7-d82dc70dbf71 60907b6b-5e38-498e-9c07-f036ebd8c658 990e110e-5e50-41a2-8ad5-92044d4465b8 EOF
func NewParser ¶
NewParser returns a Parser that uses r as the source from which to parse fastq formatted sequences.
func (*Parser) ParseAll ¶
ParseAll parses all sequences in underlying reader only returning non-EOF errors. It returns all valid fastq sequences up to error if encountered.
func (*Parser) ParseN ¶
ParseN parses up to maxSequences fastq sequences from the Parser's underlying reader. ParseN does not return EOF if encountered. If an non-EOF error is encountered it returns it and all correctly parsed sequences up to then.
func (*Parser) ParseNext ¶
ParseNext reads next fastq genome in underlying reader and returns the result and the amount of bytes read during the call. ParseNext only returns an error if it:
- Attempts to read and fails to find a valid fastq sequence.
- Returns reader's EOF if called after reader has been exhausted.
- If a EOF is encountered immediately after a sequence with no newline ending. In this case the Fastq up to that point is returned with an EOF error.
It is worth noting the amount of bytes read are always right up to before the next fastq starts which means this function can effectively be used to index where fastqs start in a file or string.
ParseNext is simplified for fastq files from fasta files. Unlike fasta files, fastq always have 4 lines following each other - not variable with a line limit of 80 like fasta files have. So instead of a for loop, you can just parse 4 lines at once.
Source Files